|
Users viewing this topic:
none
|
|
Login | |
|
RE: Defining the created kinds in baraminology - 2/14/2010 3:23:14 PM
|
|
|
drmark
Posts: 5606
Joined: 7/10/2006
Status: offline
|
No need to apologize, DanJ. Dante_A first brought up the "Bible" issue in his post #56 and you (and ManimalX) have responded appropriately for a Christian discussion forum. These agno-atheists shouldn't get a free pass just because they want to spout off their religious worldview!
_____________________________
Jeremiah 31:31-34. The time is NOW, fellow saints!
|
|
|
|
RE: Defining the created kinds in baraminology - 2/15/2010 3:34:18 AM
|
|
|
Dante_Alighieri
Posts: 304
Joined: 1/21/2010
Status: offline
|
quote:
These agno-atheists shouldn't get a free pass just because they want to spout off their religious worldview! What's your definition of "religion?" Dante
_____________________________
Nel mezzo del cammin di nostra vita mi ritrovai per una selva oscura ché la via diritta era smarrita.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/15/2010 1:00:13 PM
|
|
|
drmark
Posts: 5606
Joined: 7/10/2006
Status: offline
|
quote:
What's your definition of "religion?" We're discussing baraminology on this thread - do you have a relevant comment?
_____________________________
Jeremiah 31:31-34. The time is NOW, fellow saints!
|
|
|
|
RE: Defining the created kinds in baraminology - 2/15/2010 3:44:17 PM
|
|
|
Dante_Alighieri
Posts: 304
Joined: 1/21/2010
Status: offline
|
quote:
ORIGINAL: drmark quote:
What's your definition of "religion?" We're discussing baraminology on this thread - do you have a relevant comment? Uhh, so "These agno-atheists shouldn't get a free pass just because they want to spout off their religious worldview! " is relevant to baraminology? Dante
_____________________________
Nel mezzo del cammin di nostra vita mi ritrovai per una selva oscura ché la via diritta era smarrita.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/16/2010 5:00:52 PM
|
|
|
DanJames
Posts: 696
Joined: 12/13/2007
Status: offline
|
quote:
ORIGINAL: Dante_Alighieri I believe I've listed numerous examples of new structures arising before. Dante Where did you list numerous examples of new structures arising? I looked back through the thread and you haven't mentioned new structures evolving from old ones.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/17/2010 12:46:24 AM
|
|
|
Dante_Alighieri
Posts: 304
Joined: 1/21/2010
Status: offline
|
quote:
Where did you list numerous examples of new structures arising? I looked back through the thread and you haven't mentioned new structures evolving from old ones. Sorry, must have been a different thread. Well, I'll see if I can update you further, although the one that comes to mind is the ability of certain bacteria to digest nylon. Although, one need look know farther than new genetic material. Novel genetic material that arises can (by definition) produce new structures. And novel genetic material has also been observed directly. Dante
_____________________________
Nel mezzo del cammin di nostra vita mi ritrovai per una selva oscura ché la via diritta era smarrita.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/17/2010 1:22:22 AM
|
|
|
Dante_Alighieri
Posts: 304
Joined: 1/21/2010
Status: offline
|
Btw, could you perhaps define "novel structures"? Dante
_____________________________
Nel mezzo del cammin di nostra vita mi ritrovai per una selva oscura ché la via diritta era smarrita.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/17/2010 6:21:35 PM
|
|
|
neuronstatic
Posts: 1417
Joined: 7/14/2005
From: North Carolina!
Status: offline
|
From my understanding of medical and biochemistry observations, "new genetic material" and "novel structures" are typically a bad thing in most cases as they usually cause bad cell mutations that lead to cell death or other cellular failure. And what is the point of digesting nylon? Isn't nylon susceptible to hydrolysis and acids? It would stand to reason that given the correct chemical mix, nylon could be reduced to a consumable polymer.
_____________________________
Click here for an example of God blessing a man with a second chance at marriage in a new wife.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 3:20:53 AM
|
|
|
Dante_Alighieri
Posts: 304
Joined: 1/21/2010
Status: offline
|
quote:
From my understanding of medical and biochemistry observations, "new genetic material" and "novel structures" are typically a bad thing in most cases as they usually cause bad cell mutations that lead to cell death or other cellular failure. Most mutations are neutral. quote:
And what is the point of digesting nylon? Isn't nylon susceptible to hydrolysis and acids? It would stand to reason that given the correct chemical mix, nylon could be reduced to a consumable polymer. The point would be that it were beneficial to the bacteria. I'm going to need you to explain further on the other points. Dante
_____________________________
Nel mezzo del cammin di nostra vita mi ritrovai per una selva oscura ché la via diritta era smarrita.
|
|
|
|
Baraminology in action - 2/18/2010 1:05:21 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
I found this on another forum: ************************** "We look at the same data, just not under the same metaphysic as you." “It’s all metaphysics, and my metaphysic is the best one!” So the argument goes in this ‘debate’ – the evolution accepter, beholden as they are to the ‘metaphysic’ of Naturalistic materialism, cannot see how the creationist metaphysic – supernaturalistic antimaterialism, is far superior. It is, after all, premised on Scripture, and Scripture is Inspired. And so, if one views evidence, in the words of Henry Morris, “the right way” – that is, through the eyes of the creationist metaphysic – one will see the Truth of the creationist claims. Well, let’s take a look at this creationist metaphysic in action. I will let the objective, rational reader determine if this metaphysic is the superior one when dealing with issues scientific… When I was a graduate student working on molecular phylogenetics, I discovered a series of articles in the Creationist peer-reviewed literature * dealing with the same subject. The authors of these articles were applying computer algorithms to molecular data to determine the relationships between creatures that descended from the ‘kinds’ that were Created and were later allowed to live on the ark. These and other papers lay out the creationist version of systematics, called Baraminology (or Discontinuity Systematics), which utilize standard computer programs and reproducible analyses using molecular data. These ‘baraminologists’ have set up an entire field of study, complete with its own bible-based terminology and concepts. The first paper, “A Mitochondrial DNA Analysis of the Testudine Apobaramin,” 1997, DA Robinson, CRSQ 33:4 p. 262-272, examines the relationships between turtles, and establishes or at least lays out some important criteria for establishing affinity of species (baramina) – patterns of mutation bias, gaps between ingroup and outgroups, topological congruence of cladograms using differing parameters and analyses, and strong bootstrap support for the arrangements. The author was able to determine using these methods – which are essentially the same as those used by systematists – that all turtles are related via descent from a created kind, but could not resolve lower-level relationships. The third paper dealt with cat phylogeny, and just expanded on earlier ‘proof of concept’ papers. But the second paper was of great interest to me. “A Quantitative Approach to Baraminology With Examples from the Catarrhine Primates,” 1998, D. Ashley Robinson and David P. Cavanaugh, CRSQ 34:4 p. 196-208, was the very subject I was working on. Much of the paper consists of quoting/referring to Scripture, which is odd for a scientific paper but not, I assume, for a scientific paper premised on the supernaturalistic metaphysic, and outlining their justification for their “baraminic distance” criterion. This takes up about the first 4 pages. The baraminic distance is essentially equivalent to the materialistic genetic distance measure, it is just called something else. Those pages are, save for the references to Scripture, well written and exhibit a great deal of thought. The paper gets interesting, however, when we get to the Materials and Methods section on p. 201. The title of the paper and several sentences in the introductory portion indicate that the interest here is in the Old World monkeys, not the human-ape question. Indeed, they discount that question altogether: “Since Scriptures clearly imply that humans were specially created (Genesis 1:26-272 , 22), and thus phylogenetically distinct from other organisms, we utilize the human-nonhuman primate relationship as a control.” This will be of interest later. Their data consisted of 12s rRNA gene sequences, chromosomal characters, morphological characters, and ecological characters. The data were analyzed individually and as a total evidence dataset using standard phylogenetic analysis software. It is the results and discussion in which the metaphysic of supernaturalism comes into play. For those of you that do not know, when you set up a data matrix for analysis you utilize what is called an outgroup – a taxon that is not closely related to the group under study – for use as a ‘yardstick’ of sorts. For example, when analyzing primates you might use rabbit as an outgroup. Interestingly, as quoted above, the baraminologists use human as the outgroup in their analyses. Outgroups must be designated prior to running the analysis, or the results will appear strange. If you designate the wrong taxon as the outgroup, your results will be strange indeed (you can, of course, run analyses without an outgroup, but these analyses were not utilized by the baraminologists). So, when the baraminologists ran neighbor joining analyses on the data, they used human as the outgroup. NJ methods assume a constant rate of evolution, which is not indicated by either fossil or molecular evidence and so has fallen out of favor. Though they do not specifically state that they designated human as outgroup, this is what must have happened. This is because the order of the taxa in the dataset can influence the arrangement produced in NJ analyses. For example, I analyzed one of my datasets and I got an arrangement similar to the one seen in the CRSQ paper. Human is first in that dataset, so I cut and pasted it last, re-ran the analysis, and Human got stuck somewhere in the middle of the cluster (however, when I ran a bootstrap analysis, human grouped with chimp). However, when I designated a new world monkey as outgroup, I got the ‘accepted’ arrangement – human + chimp. Making human the outgroup produces an arrangement similar to the one in the CRSQ paper – NJ analyses by default use the first taxon as the outgroup unless designated otherwise. And what follows from that is the production of weakly supported topologies, since they tried to force the data to conform to a ‘non-natural’ topology. The node linking chimps and gorillas was supported with only 53% bootstrap support. That is fairly low. In a paper not constrained by the antimaterialism metaphysic, in which human is not the outgroup, chimps join gorilla with 96-100% support, depending on the data used. Forcing the data to fit a preconceived notion based on a metaphysic produces statistically significant error. They mention in the abstract “We have found that baraminic distances based on hemoglobin amino acid sequences, 12S-rRNA sequences, and chromosomal data were largely ineffective for identifying the Human holobaramin. Baraminic distances based on ecological and morphological characters, however, were quite reliable for distinguishing humans from nonhuman primates.” The description of the morphological analysis sounds impressive – 43 characters. The morphological characters, however, I believe, were specifically selected to produce the desired results. Why do I say this? Because this paper: Mol Phylogenet Evol. 1996 Feb; 5(1): 102-54. Primate phylogeny: morphological vs. molecular results. Shoshani J, Groves CP, Simons EL, Gunnell GF.** Was known to the authors. It contained an analysis of not 43 characters, but 264, and this analysis grouped human with chimp. The other data, ecological data, is the most subjective and should produce no surprise when it was this data that provided the baraminologists their ‘strongest evidence' for a separate human baramin. And what were some of these data? Things like percent foliage in diet, monogamy, population group size and density, home range size, etc. It looks to me like these data too were chosen to produce a desired outcome, for what exactly does “monogamy” have to do with descent? Indeed, the authors state in their Discussion section: “Character selection, not the method of analysis, is expected to be the primary factor affecting baraminic hypotheses. False conclusions can be reached unless baraminically informative data has been sampled. Since we have no a priori knowledge regarding which characters are more reliable for identifying holobaramins, it is important to evaluate the reliability of a wide variety of biological data for inferring baraminic relationships.” And later: “it is interesting to note that the ecological and morphological criteria were the most adept at distinguishing humans and the most highly correlated, indicating that the datasets in the strongest agreement were the most reliable.” Yes, that is interesting – the most subjective and limited criteria are the most reliable for giving the creationist the arrangement they want… That is, they have to pick data that give them the results they want – those that conform to Scripture. Creationism’s metaphysic in action… What I did not mention is this, from the section on selecting characters: “With the exception of the Scriptural criterion no single data set is sufficient to define the holobaramin.” Translation: Scripture gives us the answers, we need to find the data that will conform to these answers. The ‘superior’ metaphysic in action. *I had contacted the authors of this paper in 1999 asking for reprints and neither replied to my requests. I had to buy the issues from CRSQ. Later, after reading in the paper that the data sets were available from the authors on request, I sent an IM to DA Robinson while online one day. First he pretended not to know what I was talking about. After he acknowledged co-authoring the paper, he said something that astounded me – he said that he didn’t think the data sets even existed anymore! __________________ Does not come across as a legitmate, scholarly, scientific enterprise to me.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:06:29 PM
|
|
|
DanJames
Posts: 696
Joined: 12/13/2007
Status: offline
|
A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:08:53 PM
|
|
|
DanJames
Posts: 696
Joined: 12/13/2007
Status: offline
|
quote:
ORIGINAL: Dante_Alighieri quote:
From my understanding of medical and biochemistry observations, "new genetic material" and "novel structures" are typically a bad thing in most cases as they usually cause bad cell mutations that lead to cell death or other cellular failure. Most mutations are neutral. quote:
And what is the point of digesting nylon? Isn't nylon susceptible to hydrolysis and acids? It would stand to reason that given the correct chemical mix, nylon could be reduced to a consumable polymer. The point would be that it were beneficial to the bacteria. I'm going to need you to explain further on the other points. Dante The problem with the nylon example is that it is largely unexamined. I haven't seen any papers on it describing what happened to allow the nylon to be metabolized. Or maybe I'm getting it mixed up with the e coli/citrate example.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:18:50 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: DanJames A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist. Can you name such a structure that a human has that, say, a cow does not have in one form or another?
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:44:07 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: creaton quote:
ORIGINAL: DanJames A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist. Can you name such a structure that a human has that, say, a cow does not have in one form or another? Got to leave soon....
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:45:24 PM
|
|
|
DanJames
Posts: 696
Joined: 12/13/2007
Status: offline
|
quote:
ORIGINAL: creaton quote:
ORIGINAL: DanJames A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist. Can you name such a structure that a human has that, say, a cow does not have in one form or another? My knowledge of cow physiology escapes me. I'm much more of a molecular biologist.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:51:18 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: DanJames quote:
ORIGINAL: creaton quote:
ORIGINAL: DanJames A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist. Can you name such a structure that a human has that, say, a cow does not have in one form or another? My knowledge of cow physiology escapes me. I'm much more of a molecular biologist. Then how is it that you can declare "A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist"? My graduate training was in anatomy and physiology but me research was of a molecular biological nature. I am perfectly happy to discuss both.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:55:54 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: DanJames quote:
ORIGINAL: StephenJ Hey a reply! I didn't think anyone wanted to discuss this! Yes this field or section of creationism deals with the study of created kinds, or Baramins. Many creationist see these baramins as fixed, so that variation can happen within them but never to the point that a new "kind" appears. It basically allows micro-evolution or adaptation but never so called macro-evolution. The problem is that nobody has officially defined what officially makes something a kind. Is it animals that can succesfully reproduce (similar to how scientest define species)? Is it animals that share many common design features (like turtles/tortises)? Or is it something else? Taxonomy is a cloudy subject. Is there actually a definition for any of the taxonomic levels? Except maybe kingdom and domain, there isn't. The baramin is no different, except that we have a cop-out definition of saying that they were the originally created groups of animals that were capable of reproducing. Today, baraminologists are trying to find out what the original kinds were, so hold tight, and you'll get your answer It seems to me that if there ever were discreet 'kinds' of animals,that it should be relatively easy to distinguish among them, whereas if life if essentially a continuum, as evolution indicates, thaose definitions will necessarily be fuzzy.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:59:11 PM
|
|
|
DanJames
Posts: 696
Joined: 12/13/2007
Status: offline
|
quote:
ORIGINAL: creaton quote:
ORIGINAL: DanJames quote:
ORIGINAL: creaton quote:
ORIGINAL: DanJames A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist. Can you name such a structure that a human has that, say, a cow does not have in one form or another? My knowledge of cow physiology escapes me. I'm much more of a molecular biologist. Then how is it that you can declare "A new and novel structure, by my definition, is an organization of tissues which performs a function for an organism for which information did not previously exist"? Because I don't have to have knowledge of cow physiology to know that the development of a structure, to include the information coding when it is to be formed, how it is to be built, etc, can come about without a large amount of front-loaded information. quote:
My graduate training was in anatomy and physiology but me research was of a molecular biological nature. I am perfectly happy to discuss both. I look forward to it. Unfortunately this thread has gotten a little off track. However, it does seem relevant. The cow and the human would be considered separate baramin because God made them separately on day six. But my prediction is that they include genetic information that is nonhomologous enough to be considered of separate origin.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 1:59:32 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: DanJames quote:
ORIGINAL: Dante_Alighieri quote:
So sentence 2 claims there is no peer-reviewed research, yet reference [22] links to a peer-reviewed creation journal! Lol, the devil is in the details: "Baraminology is a pseudoscience[23], and has not produced any peer-reviewed scientific research"" Which is absolutely true. All reviews have been exceedingly poor, focusing on the pseudo-scientific methods used in the paper. Furthermore, come on; the CRS Quarterly is hardly a good (or even a decent) source for scientific information. Where do you get this information? I recently posted my critique of one of their papers. It is pretty bad stuff. As a molecular biologist, would YOU feel justified in stating that Scriptural considerations trump any actual evidence or analyses you might perform? quote:
quote:
Although, I do have a question for any creationists: What method specifically inhibits speciation? Dante There is no mechanism that inhibits speciation (in the normal sense, but this is all depending on your view of a species of course). There is a perfectly reasonable mechanism for a population splitting and speciating (becoming unable to interbreed with the parent population). There is, however, NO mechanism for the production of new and novel structures and/or chemical pathways. Unless you'd like to propose one, I know of none. Gene duplications, segmental duplications, etc.
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 2:00:49 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: RSchorne Show me how dogs, wolves, foxes, and all the other 35 species of the canine baramin all split into those 35 different species in only 4000 years (evolution on steroids?). And then suddenly stopped splitting and remained the same separate species some time before we started studying them ove the last several hundred years. Not to mention some 950 species of bat...
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 2:04:04 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: drmark quote:
Mutations have given certain bacteria the ability to digest nylon, for example. You certainly have studied your talkorigins propaganda well, D_A. It's a shame they forgot to remind you that nylonase is a detrimental enzyme for bacterial efficiency in every other environment without nylon! And yet THAT is exactly what evolution postulates - adaptations to the environment. I am unaware of any evolutionary tenet that dictates that evolution will produce universal adaptation. Are you?
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 2:05:22 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: drmark quote:
Evolution does not state that organisms always become "more complex," nor does it state that populations that have evolved from a different population need be "highly differentiated." Also, macroevolution (speciation) has been directly observed many times. Okay, D_A, it's become painfully obvious that you're just another in a long line of misinformed naturalists posting here who enjoy redefining"evolution" to mean whatever you need it to mean for your current bait-and-switch con game. I really don't have time for semantic gymnastics. Have a nice day and God bless. Hey Dan - did you have a little talk with this fellow about rules and such?
|
|
|
|
RE: Defining the created kinds in baraminology - 2/18/2010 2:13:56 PM
|
|
|
creaton
Posts: 180
Joined: 9/30/2008
Status: offline
|
quote:
ORIGINAL: DanJames I think that what Dr Mark is saying is that random mutations (from radiation) when tested in a lab does not produce more novel information on which natural selection can favorably act. Which mutations do you suppose are adaptive to those flies when their lab environemnt remains constant? quote:
Look, it's like I said before. Nothing is inhibity genetic changes from accumulating in a population. That happens all the time. But these genetic changes are not producing novel information which leads to upward complexity and the production of new structures. And you know this how? quote:
Changes can happen in a gene, but the gene is information. Where did the information come from? From other information? Randomness caused a protein to have a specified binding site? And other sites in which other proteins can bind? Why not? Many anti-evolutionists seem to have this odd post hoc argumentation preference - look at what we have now, and wonder/demand to know what specific series of events lead to the current state, because clearly what we have now was 'specified'. Here: TCATTTGCTTCTGACACAACTGTGTTCACTAG is a sequence of nucleotides. Here: ACATTTGCTTCTGACACAACTGTGTTCACTAG is the same sequence of nucleotides with the first nucleotide changed. The top one encodes nothing, the bottom one is the first partof the beta globin gene. Which one has more 'information'? And would you have been able to tell if I had not indicated what they represent? quote:
This is specified complexity from an information source. No, this is post hoc ergo propter hoc fallacy. quote:
That has never been demonstrated to occur in nature. It only occurs as a result of an intelligent agency. And here we finish with the ever-present argument via analogy. I will grant you that humans do things like make computers and write computer code and can 'add informaiton' to computer code. But DNA is not computer code.
|
|
|
|
New Messages |
No New Messages |
Hot Topic w/ New Messages |
Hot Topic w/o New Messages |
Locked w/ New Messages |
Locked w/o New Messages |
|
Post New Thread
Reply to Message
Post New Poll
Submit Vote
Delete My Own Post
Delete My Own Thread
Rate Posts |
|
|